Pattern Count - Bioinformatics

[Mutaz]

Greetings;

I am learning Bioinformatics and I am going to use Knime for solving Computational problems as I want to focus on the concepts instead of programming and I am familiar with Knime, do you think it is a good idea ?

My first problem is that I want to know the number of a pattern count in DNA sequence, for example I want to know how many times the pattern ACTAT mentioned in the string ACAACTATGCATACTATCGGGAACTATCCT, the answer shall be 3. As you can see there is no spaces between letters at all ! is there a node which can perform the pattern counting task ?

There are cases which I want to know the most frequent pattern consists of 4 letters for example, how can I do that ?

Thanks in advance

Regards

[aworker]

Greetings @Mutaz

The following thread solves a very similar problem:

Identify variable amount of similar sub-strings in a string and identify there positions for extraction of the sub-strings and nearby text

Hello All, new to KNIME and trying to solve the following: I have a string from which I want to extract sub-strings that all begin with the same text in this example “hoi”. The amount of times that the text “hoi” appears can vary and the text between does not follow any logic. When the text “hoi” is encountered I want to pick up the text “hoi” and let’s say the next character at the right of the text “hoi” for that I first need to know what the position is of each of the “hoi” text in the strin…

Hope it helps.

Best

Ael

[Mutaz]

Hey

Thank you for your help, but it seems that always the result of the workflow is less than the actual result, maybe it does not count the overlapping ones, is there any other way for counting or can we develop that workflow to read the overlapping sub-strings too?

Regards

[Mutaz]

Hey

I built a workflow and uploaded it on Knime hub in the following link: Pattern Count - Bioinformatics – KNIME Hub

The workflow solves the overlaps issue and include them in the count, I am sure it can be better as the user has to enter 4 inputs to have the answer

Regards

[ipazin]

Hello @Mutaz,

here is a loopless (faster) and no input needed workflow example following your logic:
Pattern Count - Bioinformatics_ipazin.knwf (44.2 KB)

Br,
Ivan